View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1919_low_12 (Length: 226)
Name: NF1919_low_12
Description: NF1919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1919_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 16 - 207
Target Start/End: Original strand, 5917650 - 5917839
Alignment:
| Q |
16 |
atgaagccgtgcactagtagagactaactttctaaatgcactacaaagatctaatcaactgtaaacacacagaaagagacccaccagtaggcatgcttcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5917650 |
atgaagccgtgcactagtagagactaactttctaaatgcactacaaagatctaatcaactgtaaacac--agaaagagacccaccagtaggcatgcttcc |
5917747 |
T |
 |
| Q |
116 |
caagatatccagaaaattataatggccaaaaactgttatttgcaaaacaggatgcagacaatcagcaacttctgcgcaaccacggccgaaag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5917748 |
caagatatccagaaaattataatggccagaaactgttatttgcaaaacaggatgcagataatcagcaacttctgcgcaaccacggccgaaag |
5917839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University