View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1919_low_3 (Length: 452)
Name: NF1919_low_3
Description: NF1919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1919_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 58 - 298
Target Start/End: Original strand, 32860727 - 32860961
Alignment:
| Q |
58 |
taaagaaaatatctatctagttctggaagacggtagtggcaccccaccacctcacaacttgaacaaattttttccattaaaaatctcaaaacgtttctaa |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860727 |
taaagaaaatatctatctagttctggaagacggtagtggcaccccaccacctcacaacttgaacaaattttttccattaaaaatctcaaaacgtttctaa |
32860826 |
T |
|
| Q |
158 |
ttttcatctctatctaaaaattcttattattcccccaaatcacagagcaaaggtgaaaaaggttaaaagagtctcaaatacaaaaccctaactaaccacc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| | | |||||||||||||||||||||||||||| |
|
|
| T |
32860827 |
--ttcatctctatctaaaaattcttattattcccccaaatcacagagcaaaggttaaaacagttcaca----ctcaaatacaaaaccctaactaaccacc |
32860920 |
T |
|
| Q |
258 |
gatccactcgaactgaagccactggctgatgtggcggttcc |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32860921 |
gatccactcgaactgaagccactggctgatgtggcggttcc |
32860961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 19 - 50
Target Start/End: Original strand, 32860177 - 32860208
Alignment:
| Q |
19 |
tgaactagtagaaaatatctaattctggtcat |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32860177 |
tgaactagtagaaaatatctaattctggtcat |
32860208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University