View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19200_high_9 (Length: 241)

Name: NF19200_high_9
Description: NF19200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19200_high_9
NF19200_high_9
[»] chr7 (2 HSPs)
chr7 (19-137)||(47688592-47688711)
chr7 (132-211)||(47688752-47688831)


Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 19 - 137
Target Start/End: Original strand, 47688592 - 47688711
Alignment:
19 gttgagtaattgagagaatttgaaaatgaaatcatatt-attcaatgatatactgagtgaaggaatacaattgagtactcaatgaaatcatattattaaa 117  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47688592 gttgagtaattgagagaatttgaaaatgaaatcatatttattcaatgatatactgagtgaaggaatacaattgagtactcaatgaaatcatattattaaa 47688691  T
118 tgaacttagtagcggtaatt 137  Q
    ||||||||||||||||||||    
47688692 tgaacttagtagcggtaatt 47688711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 211
Target Start/End: Original strand, 47688752 - 47688831
Alignment:
132 gtaattgcatatgtcagtggaaagcaaatagcaacttctttccaaaagtaatctactacatcgaactcgaaagaatccat 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||    
47688752 gtaattgcatatgtcagtggaaagcaaatagcaacttctttccaaaagtaatctattacatcgaacttgacagaatccat 47688831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University