View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19200_high_9 (Length: 241)
Name: NF19200_high_9
Description: NF19200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19200_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 19 - 137
Target Start/End: Original strand, 47688592 - 47688711
Alignment:
| Q |
19 |
gttgagtaattgagagaatttgaaaatgaaatcatatt-attcaatgatatactgagtgaaggaatacaattgagtactcaatgaaatcatattattaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47688592 |
gttgagtaattgagagaatttgaaaatgaaatcatatttattcaatgatatactgagtgaaggaatacaattgagtactcaatgaaatcatattattaaa |
47688691 |
T |
 |
| Q |
118 |
tgaacttagtagcggtaatt |
137 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47688692 |
tgaacttagtagcggtaatt |
47688711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 211
Target Start/End: Original strand, 47688752 - 47688831
Alignment:
| Q |
132 |
gtaattgcatatgtcagtggaaagcaaatagcaacttctttccaaaagtaatctactacatcgaactcgaaagaatccat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
47688752 |
gtaattgcatatgtcagtggaaagcaaatagcaacttctttccaaaagtaatctattacatcgaacttgacagaatccat |
47688831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University