View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19200_low_12 (Length: 235)
Name: NF19200_low_12
Description: NF19200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19200_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 56 - 222
Target Start/End: Complemental strand, 2208150 - 2207984
Alignment:
| Q |
56 |
gtccgatcattacttgacaaagatatttgagacattttacatcaagcacaaaagctttgggcacaaacgttgacaataaaatacttgtttgataatcata |
155 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2208150 |
gtcccatcattacttgacaaacatatttgagacattttacatcaagcacaaaagctttgggcacaaacgttgacaataaaatacttgtttgataatcata |
2208051 |
T |
|
| Q |
156 |
ttgtgcacacttcttttaaacaaggagattcttgtagcttgtgtgctatagctaaagtggtggagat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2208050 |
ttgtgcacacttcttttaaacaaggagattcttgtagcttgtgtgctatagctaaagtggtggagat |
2207984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University