View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19201_low_14 (Length: 287)
Name: NF19201_low_14
Description: NF19201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19201_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 182
Target Start/End: Original strand, 24578894 - 24579075
Alignment:
| Q |
1 |
ttctgaccttttggtgttgaacatgcactgttattgttattgttagaaacatcaattacctcagaaatttcagtcttctcttcctttgaagactcttgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24578894 |
ttctgaccttttggtgttgaacatgcactgttattgttactgttagaaacatcaattacctcagaaatttcagtcttctcttcctttgaagactcctgag |
24578993 |
T |
 |
| Q |
101 |
aggtttttgaaagacagctagaaggcaaaactttgttgattatctcttggtttttggtaggagtactactttgctgctgctg |
182 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
24578994 |
aggtttttggaagacagctagaaggcaaaactttgttgattatctcttgttttttggtatgagtactactttgctgctgctg |
24579075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 243 - 287
Target Start/End: Original strand, 24579139 - 24579183
Alignment:
| Q |
243 |
ggtccttgagattttgtttgatgctgttcttccagaaggggccat |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24579139 |
ggtccttgagattttgtttgatgctgttcttccagaaggggccat |
24579183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University