View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19201_low_17 (Length: 245)

Name: NF19201_low_17
Description: NF19201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19201_low_17
NF19201_low_17
[»] chr3 (1 HSPs)
chr3 (1-222)||(43920458-43920679)


Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 43920458 - 43920679
Alignment:
1 aggatggataaaatagaggaacgtctcgaatatgattcatgataaaaatggaaaacacaagacaaaattaggatggatacatcttatttgaacgatatta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43920458 aggatggataaaatagaggaacgtctcgaatatgattcatgataaaaatggaaaacacaagacaaaattaggatggatacatcttatttgaacgatatta 43920557  T
101 ttataaatagaaatataagagtttttcttaagacaatataaaaaacaagtgggtttgtgttgtgaacccagaaattcaattgaagagtactatgttactg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43920558 ttataaatagaaatataagagtttttcttaagacaatataaaaaacaagtgggtttgtgttgtgaacccagaaattcaattgaagagtactatgttactg 43920657  T
201 aaagattgagaacggattagat 222  Q
    ||||||||||||||||||||||    
43920658 aaagattgagaacggattagat 43920679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University