View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19201_low_7 (Length: 371)
Name: NF19201_low_7
Description: NF19201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19201_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 82 - 361
Target Start/End: Original strand, 2937191 - 2937470
Alignment:
| Q |
82 |
acttgtcatgtcaccggagttcaaatcatttctaaatcaaaactcgagaaatgcgagaagaattccaactccgacgacaatctcaactgcactaccaaaa |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2937191 |
acttgtcatgtcaccggagttcaaatcatttctaaatcaaaactcgagaaatgcgagaagaattccaactccgacgacaatctcaactgcactaccaaaa |
2937290 |
T |
 |
| Q |
182 |
tcgttctcagcatggctgttcccagtggctccagcggaggagaggcttccatcgttgcagaattggtggaagttgaagaaaattcaaccaccaaaatgca |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2937291 |
tcgttctcagcatggctgttcccagtggctccagcggaggagaggcttccatcgttgcagaattggtggaagttgaagaaaattcaaccaccaaaatgca |
2937390 |
T |
 |
| Q |
282 |
gacattgcgtgttccacctgtcattacggttaacaaaacttctgcttatgcggtttatgagttaacatatatacgagtat |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2937391 |
gacattgcgtgttccacctgtcattacggttaacaaaacttcagcttatgccgtttatgagttaacatatatacgagtat |
2937470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University