View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19201_low_7 (Length: 371)

Name: NF19201_low_7
Description: NF19201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19201_low_7
NF19201_low_7
[»] chr5 (1 HSPs)
chr5 (82-361)||(2937191-2937470)


Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 82 - 361
Target Start/End: Original strand, 2937191 - 2937470
Alignment:
82 acttgtcatgtcaccggagttcaaatcatttctaaatcaaaactcgagaaatgcgagaagaattccaactccgacgacaatctcaactgcactaccaaaa 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2937191 acttgtcatgtcaccggagttcaaatcatttctaaatcaaaactcgagaaatgcgagaagaattccaactccgacgacaatctcaactgcactaccaaaa 2937290  T
182 tcgttctcagcatggctgttcccagtggctccagcggaggagaggcttccatcgttgcagaattggtggaagttgaagaaaattcaaccaccaaaatgca 281  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2937291 tcgttctcagcatggctgttcccagtggctccagcggaggagaggcttccatcgttgcagaattggtggaagttgaagaaaattcaaccaccaaaatgca 2937390  T
282 gacattgcgtgttccacctgtcattacggttaacaaaacttctgcttatgcggtttatgagttaacatatatacgagtat 361  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||    
2937391 gacattgcgtgttccacctgtcattacggttaacaaaacttcagcttatgccgtttatgagttaacatatatacgagtat 2937470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University