View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19202_low_7 (Length: 316)
Name: NF19202_low_7
Description: NF19202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19202_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 22 - 229
Target Start/End: Original strand, 24566436 - 24566643
Alignment:
| Q |
22 |
gtaggtgctcgagtgggttaattgaacatgtcaattatattgattataaacacacagaaaaacaacttgataaaattcagtttcatcaattcaagtgatc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24566436 |
gtaggtgctcgagtgggttaattgaacatgtcaattatattgattataaacacacaggaaaacaacttgataaaattcagtttcatcaattcaagtgatc |
24566535 |
T |
 |
| Q |
122 |
gtaatttcataaatcgtatcttgtccatatctgttacccgtcaattgtcaaatcaaatatgttcacgtgatggatacttccataagataaagaaggtaac |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24566536 |
ataatttcataaatcgtatcttgtccatatctgttacccgtcaattgtcaaatcaaatatgttcacgtgatggatacttccataagataaagaaggtaac |
24566635 |
T |
 |
| Q |
222 |
ttgttatg |
229 |
Q |
| |
|
|||||||| |
|
|
| T |
24566636 |
ttgttatg |
24566643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 40 - 120
Target Start/End: Complemental strand, 45532540 - 45532459
Alignment:
| Q |
40 |
taattgaacatgtcaattatattgattataaa-cacacagaaaaacaacttgataaaattcagtttcatcaattcaagtgat |
120 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| ||||||| |||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45532540 |
taattgaacatgtcaattagattgattttaaaacacacaggaaaaaaacttgataaaattcagtttcataaattcaagtgat |
45532459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University