View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19202_low_8 (Length: 313)
Name: NF19202_low_8
Description: NF19202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19202_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 12 - 305
Target Start/End: Complemental strand, 17594674 - 17594381
Alignment:
| Q |
12 |
tcatcattcagctttgtatcctttgcacacaaaaatggaacaaaacattattcaaagatgggaagccaaagtttcaaccaaactcaaaaacaccacaaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17594674 |
tcatcattcagctttgtatcctttgcacacaaaaatggaacaaaacattattcaaagatgggaagccaaagtttcaaccaaactgaaaaacaccacaaaa |
17594575 |
T |
 |
| Q |
112 |
caacaagcatggccacttatcaaagactttttcaatctccacaaacgcttccctaacctcgccacatgttacggtatccacggatccaacggtgaggtgg |
211 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17594574 |
caacaagcatggccactcatcaaagactttttcaatctccacaaacgcttccctaacctcgccacatgttacggtatccacggatccaacggtgaggtgg |
17594475 |
T |
 |
| Q |
212 |
gatgcatacgttactgtgctggatcctccctcccatcagacggatcacaagaagtgagctggtcaaaggagagattggtagccgttgatgatgt |
305 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17594474 |
gatgcatacgttactgtgctggattctccctcccatcagacggatcacaagaagtgagctggtcaaaggagagattggtagccgttgatgatgt |
17594381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University