View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19203_low_2 (Length: 278)
Name: NF19203_low_2
Description: NF19203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19203_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 6 - 188
Target Start/End: Original strand, 49593757 - 49593939
Alignment:
| Q |
6 |
atggagattgtggttctaagctttgtaaccaagaaattaatcaaatcaacaacatttgtatcgagaggtaaggtatggctttagcatggctttcaagttt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49593757 |
atggagattgtggttctaagctttgtaaccaagaaattaatcaaatcaacaacatttgtatagagaggtaaggtatggctttagcatggctttcaagttt |
49593856 |
T |
 |
| Q |
106 |
taattaattcctcgtgcccacacatgacacatgattaagatacattggtagggtcttgcgtttacccttatacatgtctgata |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49593857 |
taattaattcctcgtgcccacacatgacacatgattaagatacattggtagggtcttgcgtttacccttatacatgtctgata |
49593939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University