View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19203_low_3 (Length: 239)
Name: NF19203_low_3
Description: NF19203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19203_low_3 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 239
Target Start/End: Original strand, 3709574 - 3709798
Alignment:
| Q |
20 |
ctaagttctcatacatggctaagtaagagaactcccacccttagcaaaaagcaagnnnnnnnnn-----ccatccttaaagctctcatgtttggttcaaa |
114 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
3709574 |
ctaagttctcatacatggctgagtaagagaactcccacccttagcaaaaagcaagagaaaaaaagaaaaccgtccttaaagctctcatgtttggttcaaa |
3709673 |
T |
|
| Q |
115 |
gaggatcaaggtcttcaccttcatcaggcacgctccacttctaggctagtcgctgatgggaagttgcactacattcaccttcatcctagggttccctttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3709674 |
gaggatcaaggtcttcaccttcatcaggcacgctccacttctaggctagtcgctgatgggaagttgcactacattcaccttcatcctagggttccctttg |
3709773 |
T |
|
| Q |
215 |
agggaagacatgaaaatatacatct |
239 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3709774 |
agggaagacatgaaaatatacatct |
3709798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University