View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19204_high_6 (Length: 213)
Name: NF19204_high_6
Description: NF19204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19204_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 19 - 197
Target Start/End: Original strand, 34239321 - 34239499
Alignment:
| Q |
19 |
tcttccgcttgtgaagcgaagctatgaaatctttcctttcttgttcacctgttggggcattcgcaggccaacctgtcttgttaaagtacgccgtcatcct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34239321 |
tcttccgcttgtgaagcgaagctatgaaatctttcctttcttgttcacctgttggggcattcgcaggccaacctgtcttgttaaagtacgccgtcatcct |
34239420 |
T |
|
| Q |
119 |
acnnnnnnncacatcaattatagcttcaagttcaaaacnnnnnnntattgtacgagtatttgaattactactcaccttt |
197 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
34239421 |
acaaaaaaacacatcaattatagcttcaagttcaaaacaaaaaaatattgtacaagtatttgaattactactcaccttt |
34239499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University