View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19204_high_8 (Length: 206)
Name: NF19204_high_8
Description: NF19204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19204_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 53 - 162
Target Start/End: Original strand, 28708229 - 28708338
Alignment:
| Q |
53 |
tttaaatagctatttagatattgagtacaaaaaataaactatatagatattgaaattgaattcaactctatgatacattaaattcaagcttatagccata |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28708229 |
tttaaatagctatttagatattgagtacaaaaaataaactatatagatattgaaattgaattcaactctatgatacattaaattcaagcttatagccata |
28708328 |
T |
 |
| Q |
153 |
gttctttcac |
162 |
Q |
| |
|
|||||||||| |
|
|
| T |
28708329 |
gttctttcac |
28708338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 28708164 - 28708201
Alignment:
| Q |
19 |
gcaacttcttgtgtcaagtgtctctcacctccacttta |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28708164 |
gcaacttcttgtgtcaagtgtctctcacctccacttta |
28708201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University