View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19204_high_8 (Length: 206)

Name: NF19204_high_8
Description: NF19204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19204_high_8
NF19204_high_8
[»] chr4 (2 HSPs)
chr4 (53-162)||(28708229-28708338)
chr4 (19-56)||(28708164-28708201)


Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 53 - 162
Target Start/End: Original strand, 28708229 - 28708338
Alignment:
53 tttaaatagctatttagatattgagtacaaaaaataaactatatagatattgaaattgaattcaactctatgatacattaaattcaagcttatagccata 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28708229 tttaaatagctatttagatattgagtacaaaaaataaactatatagatattgaaattgaattcaactctatgatacattaaattcaagcttatagccata 28708328  T
153 gttctttcac 162  Q
    ||||||||||    
28708329 gttctttcac 28708338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 28708164 - 28708201
Alignment:
19 gcaacttcttgtgtcaagtgtctctcacctccacttta 56  Q
    ||||||||||||||||||||||||||||||||||||||    
28708164 gcaacttcttgtgtcaagtgtctctcacctccacttta 28708201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University