View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19204_low_6 (Length: 239)
Name: NF19204_low_6
Description: NF19204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19204_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 1542555 - 1542763
Alignment:
| Q |
13 |
cagagatgaaattatcgatggttatatcaaaacattcgcggaggttatcggaaagtaatcatcataatatataaatgcatgatttattcttttgtctatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1542555 |
cagagatgaaattatcgatggttatatcaaaacattcgcggaggttatcggaaagtaatcatcataatatataaatgcatgatttattcttttgtctatg |
1542654 |
T |
 |
| Q |
113 |
tgggttttatctctataacattgacatgtttacatgtttaccgggattgacttgtcactgtgttttgtcatcttcatgttggtgctgcatagggttttat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1542655 |
tgggttttatctctataacattgacatgtttacatgtttaccgggattgacttgtcactgtgttttgtcatgttcatgttggtgctgcatagggttttat |
1542754 |
T |
 |
| Q |
213 |
tgatatatg |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
1542755 |
tgatatatg |
1542763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 11 - 84
Target Start/End: Original strand, 32424443 - 32424516
Alignment:
| Q |
11 |
agcagagatgaaattatcgatggttatatcaaaacattcgcggaggttatcggaaagtaatcatcataatatat |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||| |
|
|
| T |
32424443 |
agcagagatgaaattatcgatggttatatcaaaacattcgtggaggttatcggaaagtaataaccataatatat |
32424516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University