View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19205_low_10 (Length: 270)
Name: NF19205_low_10
Description: NF19205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19205_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 38280242 - 38280478
Alignment:
| Q |
17 |
atatataacatagtaattattagaaagatattttgatagaggagaagatggcgaaggattgaatgaatgttcaccttccttgtacttgtaaaccaaaatg |
116 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38280242 |
atatataagatagtaattattagaaagatattttgatagaggagaagatggcgaaggattgaatgaatgttcaccttcctagtacttgtaaaccaaaatg |
38280341 |
T |
 |
| Q |
117 |
ggaaggctacattttggtagtaaagtcgacaacatgtcaattcaacaatagttgctaaatcaatttaagatagacaacctcatcacactgttacctttaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38280342 |
ggaaggctacattttggtagtaaagtcgaaaacatgtcaattcaacaatagttgctaaatcaatttaagatagacaacctcatcacactgttacctttaa |
38280441 |
T |
 |
| Q |
217 |
agttcaaaccgcgtttcattctgtttatcagtgcttc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38280442 |
agttcaaaccgcgtttcattctgtttatcagtgcttc |
38280478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University