View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19205_low_12 (Length: 246)
Name: NF19205_low_12
Description: NF19205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19205_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 20 - 144
Target Start/End: Original strand, 10371058 - 10371182
Alignment:
| Q |
20 |
gtttccactcaaaagttcctagaatgctaggcttgtattcaagaaatggagttccttaattactaatcctaaactcattcgtatgagaaagattagtact |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10371058 |
gtttccactcaaaagttcctagaatgctaggctcgtgttcaaataatggagttccttaattactaatcctaaactcattcgtatgagaaagattggtact |
10371157 |
T |
 |
| Q |
120 |
caatatcaacatctatggttgtttg |
144 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
10371158 |
caatatcaacatctatggttgtttg |
10371182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University