View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19205_low_13 (Length: 228)
Name: NF19205_low_13
Description: NF19205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19205_low_13 |
 | |
|
| [»] scaffold0281 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 12 - 205
Target Start/End: Original strand, 15165186 - 15165379
Alignment:
| Q |
12 |
aagcataggaactgtaatatttttggggatgttgatagacaagttcggctggctgttgctgaagtgcaccgaattcagctcttaattgatacagtgggca |
111 |
Q |
| |
|
|||||| ||||| ||| ||| || |||||||||||||| ||||||||||||||||||| |||||||||||| ||||||| |||||||||||| |||||| |
|
|
| T |
15165186 |
aagcattggaaccgtactatcttcggggatgttgataggcaagttcggctggctgttgatgaagtgcaccggattcagcatttaattgatacattgggca |
15165285 |
T |
|
| Q |
112 |
ttacagatcagctatatgaccaagatcttgaggctcagttactcctcaccaaagctttaaatgttcaggaccagctttggaaagaaaaggctag |
205 |
Q |
| |
|
|||| | |||| |||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
15165286 |
ttacggctcagttatatgcccaagatcttgaggctcagttactcctcaccaaagctttgaatgctcaggaccagctttggaaagaaaaggctag |
15165379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0281 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0281
Description:
Target: scaffold0281; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 205
Target Start/End: Original strand, 7776 - 7864
Alignment:
| Q |
117 |
gatcagctatatgaccaagatcttgaggctcagttactcctcaccaaagctttaaatgttcaggaccagctttggaaagaaaaggctag |
205 |
Q |
| |
|
|||||||| |||| || ||||||||||| || || || || ||||| ||||||||| ||||||| || || |||| |||||||||||| |
|
|
| T |
7776 |
gatcagctctatgttcaggatcttgaggcacaattgcttctaaccaaggctttaaattttcaggagcaactgtggagagaaaaggctag |
7864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University