View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19206_high_20 (Length: 235)
Name: NF19206_high_20
Description: NF19206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19206_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 5 - 220
Target Start/End: Complemental strand, 10189118 - 10188903
Alignment:
| Q |
5 |
cccaacgcaagcctacaccgacgatcatctttcagtgggtgactgtctgcagtgatgccaccgcaatccttcttgtaggatgagagaagtgctttagcct |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10189118 |
cccaacgcaagcctacaccgacgatcatctttcagtgggtgactgtctgcggtgatgccacctcaatccttcttgtaggatgagagaagtgctttagcct |
10189019 |
T |
|
| Q |
105 |
cactgaggtgcgtgttataacgcatggtatgtgcacgtaggacaggaaagcgtttgaaggcagaaatggtccacttaggatcttcttcgagatatagcgt |
204 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10189018 |
cactgaggcgcgtgttataacgcatggtatgtgcacgtaggacaggaaagcgtttgaaggcagaaatggtccacttaggatcttcttcgagatatagtgt |
10188919 |
T |
|
| Q |
205 |
gatgccgcgtggatta |
220 |
Q |
| |
|
|||||| ||||||||| |
|
|
| T |
10188918 |
gatgccacgtggatta |
10188903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University