View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19206_low_24 (Length: 207)

Name: NF19206_low_24
Description: NF19206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19206_low_24
NF19206_low_24
[»] chr7 (1 HSPs)
chr7 (20-192)||(40620231-40620403)


Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 20 - 192
Target Start/End: Complemental strand, 40620403 - 40620231
Alignment:
20 tttgggacatggccaacggcattattacttgcaaacagaaaaagagtgataattgaaggacctgtttgtgaatcatctcaagttattggatggcatttaa 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
40620403 tttgggacatggccaacggcattattacttgcaaacagaaaaagagtgataattgaaggacctgtttgtgactcatctcaagttattggatggcatttaa 40620304  T
120 ggagtatgaacaatgagacaatcacttctcccattcatatttcaagttttgcattcaatagctccattctgtg 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40620303 ggagtatgaacaatgagacaatcacttctcccattcatatttcaagttttgcattcaatagctccattctgtg 40620231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University