View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19207_high_19 (Length: 251)
Name: NF19207_high_19
Description: NF19207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19207_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 20 - 246
Target Start/End: Original strand, 15571040 - 15571266
Alignment:
| Q |
20 |
actacaatattactcttatttgctcaactctcctatctagtttcttcacaaataaataaagaaaaatggctatggaaaaatcaaattcctttgagaacat |
119 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15571040 |
actacaatattactctaatttgctcaactctcctatctagtttcttcacaaataaataaagaaaaatggctatggaaaaatcaaattcctttgagaacat |
15571139 |
T |
|
| Q |
120 |
gaaacattacactgctatgatatgtttacaatttggctatgctggtatgaacattatcactaaggtttccctcaaccaaggaatgagccactatgtcctc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15571140 |
gaaacattacactgctatgatatgtttacaatttggctatgctggtatgaacattatcactaaggtttccctcaaccaaggaatgagccactatgtcctc |
15571239 |
T |
|
| Q |
220 |
gtcgtttatcgccacgcctttgctact |
246 |
Q |
| |
|
||||||||||||||||| ||||||||| |
|
|
| T |
15571240 |
gtcgtttatcgccacgcttttgctact |
15571266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 144 - 242
Target Start/End: Complemental strand, 3434964 - 3434866
Alignment:
| Q |
144 |
tttacaatttggctatgctggtatgaacattatcactaaggtttccctcaaccaaggaatgagccactatgtcctcgtcgtttatcgccacgcctttgc |
242 |
Q |
| |
|
|||||| ||||||||||| || |||||||| || || ||| |||| ||||| ||| ||||| |||||||||||||| ||||||||||| || ||||| |
|
|
| T |
3434964 |
tttacagtttggctatgcaggcatgaacatcataaccaagctttctctcaatggagggatgagtcactatgtcctcgttgtttatcgccatgcttttgc |
3434866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University