View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19207_high_6 (Length: 439)
Name: NF19207_high_6
Description: NF19207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19207_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 16 - 373
Target Start/End: Complemental strand, 23253494 - 23253144
Alignment:
| Q |
16 |
attatgttgttaattaatatcttattatgtcttcctagggttttgcattgcattttggaagtaaatgtgtttgcatatggcatttatgcacgatttttcg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23253494 |
attatgttgttaattaatatcttattatgccttcctaggattttgcatggcattttagaagtaaatgtgtttgcatatggcatttatgcacgatttttcg |
23253395 |
T |
 |
| Q |
116 |
aatacttatgatgtgtgtatacgctatgtagcaccgacacttctgatggaaggtgtgttcggttttgacacaacaccgacacatttgattacattcaann |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23253394 |
aatacttatgatgtgtgtatacgccatgtagcaccgacacttctgatggaaggtgtgttcggttttgacacaacaccgacacatttgattacattcaatt |
23253295 |
T |
 |
| Q |
216 |
nnnnnaaattttgtgtcgatgtgtccgtgtcatgtctgatgtctgtgcttgtggttcatagcgtataagtggcataataggaatctaggaaggttgaaag |
315 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23253294 |
tttttaaattttgtgtcgacgtgtccgtgtc-------atgtctgtgtttgtggttcatagcgtataagtggcataataggaatctaggaaggttgaaag |
23253202 |
T |
 |
| Q |
316 |
tgaaatgcaactcatttactttccgtcctacataatatagccacttttgtagcatgaa |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23253201 |
tgaaatgcaactcatttactttccgtcctacataatatagccacttttgtagcatgaa |
23253144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 142 - 178
Target Start/End: Complemental strand, 4790816 - 4790780
Alignment:
| Q |
142 |
tgtagcaccgacacttctgatggaaggtgtgttcggt |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4790816 |
tgtagcaccgacacttctgattgaaggtgtgttcggt |
4790780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 138 - 173
Target Start/End: Complemental strand, 5243337 - 5243302
Alignment:
| Q |
138 |
gctatgtagcaccgacacttctgatggaaggtgtgt |
173 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5243337 |
gctatgtagcaccgacacttctgattgaaggtgtgt |
5243302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 139 - 178
Target Start/End: Original strand, 51603400 - 51603439
Alignment:
| Q |
139 |
ctatgtagcaccgacacttctgatggaaggtgtgttcggt |
178 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
51603400 |
ctatgtagcaccgacacatctgatcgaaggtgtgttcggt |
51603439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 139 - 173
Target Start/End: Original strand, 35053683 - 35053717
Alignment:
| Q |
139 |
ctatgtagcaccgacacttctgatggaaggtgtgt |
173 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
35053683 |
ctatgtagcaccgacacttctgattgaaggtgtgt |
35053717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 139 - 173
Target Start/End: Original strand, 35070000 - 35070034
Alignment:
| Q |
139 |
ctatgtagcaccgacacttctgatggaaggtgtgt |
173 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
35070000 |
ctatgtagcaccgacacttctgattgaaggtgtgt |
35070034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 142 - 178
Target Start/End: Original strand, 5409083 - 5409119
Alignment:
| Q |
142 |
tgtagcaccgacacttctgatggaaggtgtgttcggt |
178 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
5409083 |
tgtagcaccgaaacttctgatggaaggtgtgtccggt |
5409119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 181 - 213
Target Start/End: Complemental strand, 47542599 - 47542567
Alignment:
| Q |
181 |
tgacacaacaccgacacatttgattacattcaa |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
47542599 |
tgacacaacaccgacacatgtgattacattcaa |
47542567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 181 - 213
Target Start/End: Complemental strand, 47542818 - 47542786
Alignment:
| Q |
181 |
tgacacaacaccgacacatttgattacattcaa |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
47542818 |
tgacacaacaccgacacatgtgattacattcaa |
47542786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 181 - 213
Target Start/End: Complemental strand, 47543037 - 47543005
Alignment:
| Q |
181 |
tgacacaacaccgacacatttgattacattcaa |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
47543037 |
tgacacaacaccgacacatgtgattacattcaa |
47543005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 181 - 213
Target Start/End: Complemental strand, 47556265 - 47556233
Alignment:
| Q |
181 |
tgacacaacaccgacacatttgattacattcaa |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
47556265 |
tgacacaacaccgacacatgtgattacattcaa |
47556233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 181 - 213
Target Start/End: Complemental strand, 47556484 - 47556452
Alignment:
| Q |
181 |
tgacacaacaccgacacatttgattacattcaa |
213 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
47556484 |
tgacacaacaccgacacatgtgattacattcaa |
47556452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University