View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19207_low_19 (Length: 259)
Name: NF19207_low_19
Description: NF19207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19207_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 29062700 - 29062477
Alignment:
| Q |
1 |
agcagtttgaatatttatctggaaattagaacaaaaaatcagaattgaaccacaatctcaatgttgaataaaaatgagaatacgtatatttattataaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
29062700 |
agcagtttgaatatttatctggaaattagaacaaaaaataagaattgaaccacaatctcaatgttcaataaaaatgagaatacgtatatttattatcaaa |
29062601 |
T |
|
| Q |
101 |
tgattaatatcaaagaaaacatagcataatcatatcatgtatataagttggtagagatattgcatatcttatgcatgggttgaggttcgaatct---aca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||| |||||| |||||||| || ||| |
|
|
| T |
29062600 |
tgattaatatcaaagaaaacatagcataatcatatcatgtatataagttggcagggatattgcatatcatatgcaggggttggggttcgaacctcagaca |
29062501 |
T |
|
| Q |
198 |
tctcatttctccacaatttactgt |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
29062500 |
tctcatttctccacaatttactgt |
29062477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 146 - 191
Target Start/End: Complemental strand, 39966128 - 39966083
Alignment:
| Q |
146 |
agttggtagagatattgcatatcttatgcatgggttgaggttcgaa |
191 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
39966128 |
agttggtagggatattgcatattatatgcaggggttgaggttcgaa |
39966083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 146 - 215
Target Start/End: Complemental strand, 4553600 - 4553528
Alignment:
| Q |
146 |
agttggtagagatattgcatatcttatgcatgggttgaggttcgaatct---acatctcatttctccacaatt |
215 |
Q |
| |
|
|||||||||| ||||||||||| |||||| ||| |||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
4553600 |
agttggtagaaatattgcatattatatgcaggggctgaggttcgaatctcggacacctcacttctccacaatt |
4553528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University