View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19207_low_27 (Length: 231)

Name: NF19207_low_27
Description: NF19207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19207_low_27
NF19207_low_27
[»] chr4 (2 HSPs)
chr4 (45-99)||(47561128-47561182)
chr4 (165-211)||(47561248-47561294)


Alignment Details
Target: chr4 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 45 - 99
Target Start/End: Original strand, 47561128 - 47561182
Alignment:
45 agtatgagggaaggaagcatcgtgtttgagtagtggagagggtgagtcgttttgt 99  Q
    |||||||||||||||||| ||||||||||||||||||||||||||| ||||||||    
47561128 agtatgagggaaggaagcgtcgtgtttgagtagtggagagggtgagccgttttgt 47561182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 47561248 - 47561294
Alignment:
165 gatgggtataccgcggtccatctcagcccatacaatgctccgccacc 211  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||    
47561248 gatgggtataccgcggtccatctcagccgatacaatgctccgccacc 47561294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University