View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19207_low_27 (Length: 231)
Name: NF19207_low_27
Description: NF19207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19207_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 45 - 99
Target Start/End: Original strand, 47561128 - 47561182
Alignment:
| Q |
45 |
agtatgagggaaggaagcatcgtgtttgagtagtggagagggtgagtcgttttgt |
99 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47561128 |
agtatgagggaaggaagcgtcgtgtttgagtagtggagagggtgagccgttttgt |
47561182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Original strand, 47561248 - 47561294
Alignment:
| Q |
165 |
gatgggtataccgcggtccatctcagcccatacaatgctccgccacc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47561248 |
gatgggtataccgcggtccatctcagccgatacaatgctccgccacc |
47561294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University