View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19207_low_28 (Length: 231)
Name: NF19207_low_28
Description: NF19207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19207_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 14 - 118
Target Start/End: Complemental strand, 36000667 - 36000563
Alignment:
| Q |
14 |
attatactctcatcaaagggaaatagtagtgtttaggaatcaaagtttaccgattgatagattcacatggagattcttacgatttcaacccaattttagg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36000667 |
attatactctcatcaaagggaaatagtagtgtttagaaatcaaagtttaccaattgatagattcacatggagattcttacgatttcaacccaattttaga |
36000568 |
T |
 |
| Q |
114 |
agttt |
118 |
Q |
| |
|
||||| |
|
|
| T |
36000567 |
agttt |
36000563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 36000495 - 36000456
Alignment:
| Q |
182 |
ggggtaattgatgttaagaaacttattaacaatctgatga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36000495 |
ggggtaattgatgttaagaaacttattaacaatctgatga |
36000456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University