View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19207_low_28 (Length: 231)

Name: NF19207_low_28
Description: NF19207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19207_low_28
NF19207_low_28
[»] chr4 (2 HSPs)
chr4 (14-118)||(36000563-36000667)
chr4 (182-221)||(36000456-36000495)


Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 14 - 118
Target Start/End: Complemental strand, 36000667 - 36000563
Alignment:
14 attatactctcatcaaagggaaatagtagtgtttaggaatcaaagtttaccgattgatagattcacatggagattcttacgatttcaacccaattttagg 113  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||     
36000667 attatactctcatcaaagggaaatagtagtgtttagaaatcaaagtttaccaattgatagattcacatggagattcttacgatttcaacccaattttaga 36000568  T
114 agttt 118  Q
    |||||    
36000567 agttt 36000563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 36000495 - 36000456
Alignment:
182 ggggtaattgatgttaagaaacttattaacaatctgatga 221  Q
    ||||||||||||||||||||||||||||||||||||||||    
36000495 ggggtaattgatgttaagaaacttattaacaatctgatga 36000456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University