View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19208_low_1 (Length: 347)
Name: NF19208_low_1
Description: NF19208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19208_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 220 - 340
Target Start/End: Complemental strand, 35419608 - 35419487
Alignment:
| Q |
220 |
agagaacata-gtcctctataggcgaaagctaaaattaatctaggtcggcttagttttctcaactaattctctttcgttcaaacgattaacaccgatgaa |
318 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35419608 |
agagaacataagtcctctataggcgaaagctaaaattaatctaggtcggcttagttttctcaactacatctctttcgttcaaacgattaacaccgatgaa |
35419509 |
T |
 |
| Q |
319 |
ggaattttatccctcctctgtg |
340 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35419508 |
ggaattttatccctcctctgtg |
35419487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University