View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19209_high_6 (Length: 501)
Name: NF19209_high_6
Description: NF19209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19209_high_6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 456; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 456; E-Value: 0
Query Start/End: Original strand, 22 - 501
Target Start/End: Original strand, 21283691 - 21284170
Alignment:
| Q |
22 |
aggatttgttgagggcttcagcttatgtggtggggaagagtaggagtgggattgtttataaagttgttggtggagggaaagggtctgttccggcagcgac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21283691 |
aggatttgttgagggcttcagcttatgtggtggggaagagtaggagtgggattgtttataaagttgttggtggagggaaagggtctgttccggcagcgac |
21283790 |
T |
 |
| Q |
122 |
agtggcggttagacggttgagtgagggcgacgatggtggtttacggtttaaggaatttgaggctgaggtggaggctattgggagactgagacaccctaat |
221 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21283791 |
agtggcggttagacggttgagtgagggtgacgatggtggtttacggtttaaggaatttgaggctgaggtggaagctattgggagactgagacaccctaat |
21283890 |
T |
 |
| Q |
222 |
gttgtgcctttgagagcttattactatgctagtgatgagaaacttctcatcactgatttcattcgcaatggaagcttgcacactgctttgcatggtatca |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21283891 |
gttgtgcctttgagagcttattactatgctagtgatgaaaaacttctcatcactgatttcattcgcaatggaagcttgcacactgctttgcatggtatcg |
21283990 |
T |
 |
| Q |
322 |
cttctcatactttttagttctttgtttaattagtctacattttgatttctatgtgaaaatctatgactttactttgatcaaattgtataaatctatgatt |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21283991 |
cttctcatactttttagttctttgtttaattagtctacattttgatttctatgtgaaaatctatgactttacattgatcaaattgtataaatctatgatt |
21284090 |
T |
 |
| Q |
422 |
aatgcttaatttggatgtcaatgtttgtctttgattgcaaattcatgtagtaaggaaatcacttttcaaatgctacattt |
501 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21284091 |
aatgcttaatttggatgtcaatgtttgtttttgattgcaaattcatgtagtaaggaaatcacttttcaaatgctacattt |
21284170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University