View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19210_high_35 (Length: 262)

Name: NF19210_high_35
Description: NF19210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19210_high_35
NF19210_high_35
[»] chr1 (1 HSPs)
chr1 (146-249)||(23755780-23755884)


Alignment Details
Target: chr1 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 146 - 249
Target Start/End: Complemental strand, 23755884 - 23755780
Alignment:
146 gcttaggtttcttcgatctt-gcttattattgtgtttagatcatagatcataattaatttaattaattcattttatgaatctaattaatttctgattttg 244  Q
    |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
23755884 gcttaggtttgttcgatctttgcttattattgtgtttagatcatagatcataattaatttaattaatccattttatgaatctaattaatttctgattttg 23755785  T
245 ttgat 249  Q
    |||||    
23755784 ttgat 23755780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University