View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19210_low_19 (Length: 377)
Name: NF19210_low_19
Description: NF19210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19210_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 132 - 365
Target Start/End: Original strand, 45578259 - 45578492
Alignment:
| Q |
132 |
tttgtcatttaaaaaatttccatttgtatgcgtccaaatatttatgattagaggggtggtggctaatgaatcttggagaaagaacgacgtgtcaagcatc |
231 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45578259 |
tttgtcatttaaaatattttcatttgtatgcgtccaaatatttatgattagaggggtggtggctaatgaatcttggagaaagaacgacgtgtcaagcatc |
45578358 |
T |
|
| Q |
232 |
tagatgaaaagagaaagatttcgataagcatcgtacgttgattaggtagttagaggatctgtaagtttacacaccgtgtatctcacctacgaggaagctc |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45578359 |
tagatgaaaagagaaagatttcgataagcatcgtacgttgattaggtagttagaggatctgtaagtttacacaccgtgtatctcacctacgaggaagctc |
45578458 |
T |
|
| Q |
332 |
gctcgtgtctgctgtgtgcttttaactaccattt |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45578459 |
gctcgtgtctgctgtgtgcttttaactaccattt |
45578492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 16 - 62
Target Start/End: Original strand, 45578143 - 45578189
Alignment:
| Q |
16 |
ataacctactaaaatatgcatagctcaaaattttaatggacaacgtc |
62 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45578143 |
ataacctactaaaatatgcatagttcaaaattttaatggacaacgtc |
45578189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University