View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19210_low_30 (Length: 301)
Name: NF19210_low_30
Description: NF19210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19210_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 13 - 284
Target Start/End: Complemental strand, 31028876 - 31028602
Alignment:
| Q |
13 |
aaaataaaaattgcatttaagtcatattatttttactgaggggccattatatttatatgtagccgaaaggcctacacgtttgcatattatatcattcgtg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31028876 |
aaaataaaaattgcatttaagtcatattatttttaccgaggggacattatatttatatgtagccgaaaggcctacacgtttgcatattatatcattcgtg |
31028777 |
T |
 |
| Q |
113 |
tctccatctttgatgctctgcaattatagctctgcggggcctgatcttatattcttttttaattggttgataatctagtcatat---actatatgttata |
209 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
31028776 |
tctccatctttgatgttctgcaattatagctctgcggggcctgatcttatattcttttttaatttgttgataatctagtcatatactactatatgttata |
31028677 |
T |
 |
| Q |
210 |
ctttgccaagacaacataccattatgggataagaaaaatatgctcacgtagagtacaagcatgaaaataatcagt |
284 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31028676 |
ctttgccaagacaaaataccattatgggataagaaaaatatgctcacgtagagtacaagcatgaaaaaaatcagt |
31028602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University