View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19210_low_37 (Length: 262)
Name: NF19210_low_37
Description: NF19210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19210_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 146 - 249
Target Start/End: Complemental strand, 23755884 - 23755780
Alignment:
| Q |
146 |
gcttaggtttcttcgatctt-gcttattattgtgtttagatcatagatcataattaatttaattaattcattttatgaatctaattaatttctgattttg |
244 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23755884 |
gcttaggtttgttcgatctttgcttattattgtgtttagatcatagatcataattaatttaattaatccattttatgaatctaattaatttctgattttg |
23755785 |
T |
 |
| Q |
245 |
ttgat |
249 |
Q |
| |
|
||||| |
|
|
| T |
23755784 |
ttgat |
23755780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University