View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19210_low_38 (Length: 257)
Name: NF19210_low_38
Description: NF19210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19210_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 33 - 249
Target Start/End: Complemental strand, 10929265 - 10929048
Alignment:
| Q |
33 |
attattaatactatttg---atagtcctacattgcccatgttgaggggcaatatgaaagcaggagatatggggaatcacgtggcaactgtagggtgggtt |
129 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10929265 |
attattaatactatttgttgatagtcctacattgcccatgttgaggggcaatatgaaagcaggagatatggggaatcacgtggcaactgtagggtgggtt |
10929166 |
T |
|
| Q |
130 |
gtgaataaatatgaggtggtgagggatgagattttatgagagatatgtccatctttatcagacaatgagtgtcctttgtatttatcttggaaaggagatc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10929165 |
gtgaataaatatgaggtggtgagggatgagattttatgagag--atgtccatctttatcagacaatgagtgtcctttgtatttatcttggaaaggagatc |
10929068 |
T |
|
| Q |
230 |
ttaccaaatcatgtttgcct |
249 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
10929067 |
ttaccaaatcatgtttgcct |
10929048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University