View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19210_low_39 (Length: 255)
Name: NF19210_low_39
Description: NF19210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19210_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 46304467 - 46304695
Alignment:
| Q |
18 |
tcttttataatgtacattatacattataacttggatatttctaatatttcagttgtggtatgttttgcacaatgatacagtggattgcgagggaatatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46304467 |
tcttttataatgtacattatacattataacttggatatttctaatatttcagttgtggtatgttttgcacaatgatacagtggattgcgagggaatatgt |
46304566 |
T |
 |
| Q |
118 |
tgactggaattttgtctccggatatttgccaattatctggtttgtggtacttgtgagtaatcaagccctgtcatatttaa-nnnnnnnatatgtactaag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46304567 |
tgactggaattttgtctccggatatttgccaattatctggtttgtggtacttgtgagtaatcaagccctgtcatatttaattttttttatatgtactaag |
46304666 |
T |
 |
| Q |
217 |
tttattctagacttctgttttgacctttg |
245 |
Q |
| |
|
|||||||| ||||||||||||||| |||| |
|
|
| T |
46304667 |
tttattctggacttctgttttgacttttg |
46304695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 98 - 169
Target Start/End: Original strand, 26377138 - 26377209
Alignment:
| Q |
98 |
tggattgcgagggaatatgttgactggaattttgtctccggatatttgccaattatctggtttgtggtactt |
169 |
Q |
| |
|
||||||||||||||| ||||||| |||| |||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
26377138 |
tggattgcgagggaacatgttgattggatttttgtctcctgatatttgccaattatctagtttgtggtactt |
26377209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University