View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19210_low_44 (Length: 248)

Name: NF19210_low_44
Description: NF19210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19210_low_44
NF19210_low_44
[»] chr5 (1 HSPs)
chr5 (18-155)||(7059322-7059459)


Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 18 - 155
Target Start/End: Original strand, 7059322 - 7059459
Alignment:
18 caaagggtggaaccaccacctcagagacggtggtgtttatggtggttgtggattgcattgcttggttttctgagaagtcttgctgtctattgattgcaac 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7059322 caaagggtggaaccaccacctcagagacggtggtgtttatggtggttgtggattgcattgcttggttttctgagaagtcttgctgtctattgattgcaac 7059421  T
118 tagtgaagggtcgttttcagctgcattgatatcagatc 155  Q
    ||||||||||||||||||||||||||||||||||||||    
7059422 tagtgaagggtcgttttcagctgcattgatatcagatc 7059459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University