View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19210_low_45 (Length: 244)
Name: NF19210_low_45
Description: NF19210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19210_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 16 - 93
Target Start/End: Original strand, 6563860 - 6563937
Alignment:
| Q |
16 |
attatactatatatagatgatgaggttcgaatcctaaatacctcaattattaactttaaaaaatgtaatttgtagcaa |
93 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6563860 |
attatattatatatagatgatgaggttcgaatcctaaataccttaattattaactttaaaaaatgtaatttgtagcaa |
6563937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University