View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19210_low_46 (Length: 241)
Name: NF19210_low_46
Description: NF19210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19210_low_46 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 55372675 - 55372456
Alignment:
| Q |
18 |
gaaactgctttgcagaaaattagctttctatcatttggcattttcaataggctattattttggataatgcattgcaacagtgnnnnnnnnnc--ttctca |
115 |
Q |
| |
|
||||||| |||| |||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
55372675 |
gaaactgttttgtagaaaattagctttgtatcatttggcattttcaata-----ttattttggataatgcattgcaacagtgttttttttttctttctca |
55372581 |
T |
 |
| Q |
116 |
attacttgagataaaatataatcaaaacataaagatgccaacaagtaattatcagaaaaattgtgaagcaagtctatggcctgaccatccttggataatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55372580 |
attacttgagataaaatataatcaaa-cattaagatgccaacaagtaattatcagaaaaattgtgaagcaagtctatggcctgaccatccttggataatc |
55372482 |
T |
 |
| Q |
216 |
aaataagtgtttataataagctattt |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
55372481 |
aaataagtgtttataataagctattt |
55372456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University