View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19210_low_50 (Length: 240)
Name: NF19210_low_50
Description: NF19210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19210_low_50 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 29907848 - 29907625
Alignment:
| Q |
19 |
gccacagctaagttttt--ctgatttatagagatatgaatatagatatcctcagttgacagaaactacttcgattgtaatgacgggcatttactgggtgt |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29907848 |
gccacagctaagtttttttctgatttatagagatatgaatataaatatcctcagttgacagaaactacttcgattgtaatgacgggcatttactgggtgt |
29907749 |
T |
 |
| Q |
117 |
taattatcttttactgtgttcgttaattttattttagggtgaaaatgatggattttatcctgctgaaatgtataaattgtttgtttagggtgcagccctt |
216 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29907748 |
taattgtcttttactgtgttcgttaattttattttagggtgaaaatgatggattttatcctgctgaaatggataaattgtttgtttagggtgcagccctt |
29907649 |
T |
 |
| Q |
217 |
tcaccttctaatgctgcagaatct |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
29907648 |
tcaccttctaatgctgcagaatct |
29907625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University