View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19210_low_56 (Length: 226)
Name: NF19210_low_56
Description: NF19210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19210_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 20 - 205
Target Start/End: Complemental strand, 21828634 - 21828449
Alignment:
| Q |
20 |
caaacctccaaatcaagaggataaagtcgcaattttgacgaaagatttgatttgtgtagcttctgattctgttagtgttacgtctattttagatgagaat |
119 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21828634 |
caaacctctaaatcaagaggataaagtcgcaattttggtcaaagatttgatttgtgtagcttctgattctgttagtgttacgtctattttggatgagaat |
21828535 |
T |
|
| Q |
120 |
tctgaatttttgattggatctcaccctgtttattttcaacttttgaatcaattggattcaaaaccttcccttttacttgaggtaat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21828534 |
tctgaatttttgattggatctcaccctgtttatattcaacttttgaatcaattggattcaaaaccttcccttttacttgaggtaat |
21828449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 20 - 203
Target Start/End: Complemental strand, 32373276 - 32373093
Alignment:
| Q |
20 |
caaacctccaaatcaagaggataaagtcgcaattttgacgaaagatttgatttgtgtagcttctgattctgttagtgttacgtctattttagatgagaat |
119 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||| ||| ||||| |
|
|
| T |
32373276 |
caaacctccaaatcaagaggacaaagtcgcaattttgacgaaagatttgatttgtgtagcttctgattctgttagggtttcatctattttggatcagaat |
32373177 |
T |
|
| Q |
120 |
tctgaatttttgattggatctcaccctgtttattttcaacttttgaatcaattggattcaaaaccttcccttttacttgaggta |
203 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32373176 |
tctgaatatttgattggatctcaccctgtttatattcaacttttgaatcaattgaattcaaaaccttcccttttacttgaggta |
32373093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University