View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19210_low_57 (Length: 224)
Name: NF19210_low_57
Description: NF19210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19210_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 94 - 188
Target Start/End: Original strand, 40371006 - 40371100
Alignment:
| Q |
94 |
tttacaaaagaatttcttgcatctccataagttatgttttttcacatcaaaagaagaaaaacatgattaaaattctcaagattatttatggtatg |
188 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
40371006 |
tttacaaaataatttcttgcatcttcataagttatgttttttcacatcaaaagaagaaaaacataattaaaattctcaagttaatttatggtatg |
40371100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 40370907 - 40370988
Alignment:
| Q |
18 |
catttattgagtgacatagaggaacaagcacaacaacacatgaatgtatgtaaaggactttcaacaatgacactagtttacaaaa |
102 |
Q |
| |
|
||||||| |||||||||| ||||||| |||||| |||||||||||||||||| ||||||||| ||| |||||||||||||||| |
|
|
| T |
40370907 |
catttatcgagtgacataaaggaacacgcacaa---cacatgaatgtatgtaaaagactttcaaaaataacactagtttacaaaa |
40370988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University