View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19212_high_28 (Length: 202)
Name: NF19212_high_28
Description: NF19212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19212_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 46 - 189
Target Start/End: Original strand, 32266640 - 32266783
Alignment:
| Q |
46 |
ctctagacaacaacatcaaacatctagcaacctcttcttgttgttcctgttccatctcagaaacagatgaagaaccgccattaacagaagaagaagaagg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32266640 |
ctctagacaacaacatcaaacatctagcaacctcttcttgttgttcctgttccatctcagaaacagatgaagaaccaccattaacagaagaagaagaagg |
32266739 |
T |
 |
| Q |
146 |
ttgatgatttgaaagagtaatagacttgaacctaattcttctct |
189 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32266740 |
ttgctgatttgaaagagtaatagacttgaacctaattcttctct |
32266783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University