View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19213_high_11 (Length: 284)
Name: NF19213_high_11
Description: NF19213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19213_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 10 - 267
Target Start/End: Complemental strand, 36462877 - 36462628
Alignment:
| Q |
10 |
aagaatatagcaggttaacaacaaagctggtgtgttattgaatgtcattagacctcaatcatgtgaagataaaggatgttgcagcttactttaaactgat |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36462877 |
aagaatgtagcaggttaacaacaaagctggtgtgttattgaatgtaattagacctcaatcatgtgaagataaaggacgttgcagcttactttaaactgat |
36462778 |
T |
|
| Q |
110 |
agctattgtgtaacagggtctacctataccaccatgtt-ggaggattatgattagcatgatgcacatatagtcagtcaattactagtgttttgttttttc |
208 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36462777 |
agctattgtgtaacagggtctacct-----accatgttgggaggattatgattagcatgatgcacatat----agtcaattactagtgttttgttttttc |
36462687 |
T |
|
| Q |
209 |
ttgcctgattgtagttcaatgacatctagctcttgattgcttgcttgtggtggtgtatt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36462686 |
ttgcctgattgtagttcaatgacatctagctcttgattgcttgcttgtggtggtgtatt |
36462628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University