View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19213_high_14 (Length: 272)
Name: NF19213_high_14
Description: NF19213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19213_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 11 - 253
Target Start/End: Complemental strand, 44761890 - 44761648
Alignment:
| Q |
11 |
agaatattcctcaggattacgagaggcgttcatccaaaaaagtaagaagaccatgctttgaaaactgtgtgaattggatgcaagtatatactaatatgtt |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44761890 |
agaatattcctcgggattacgagaggcgttcatccaaaaaagtaagaagaccatgctttgaaaactgtgtgaattggatgcaagtatatactaatatgtt |
44761791 |
T |
|
| Q |
111 |
atctcactagtgattaaaaatataacccacgtgaatatgttggtttgctcttgatgaattatagtcaacaattatgactctcaacataagggaatttgcc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
44761790 |
atctcactagtgattaaaaatataacccacgtgaatatgttggtttgctcttgatgaattatagtcaataattatgactgtcaacataagggaatttgcc |
44761691 |
T |
|
| Q |
211 |
tcattttctccatctggcatttacagggtttcgttaggtattg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44761690 |
tcattttctccatctggcatttacagggtttcgttaggtattg |
44761648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University