View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19213_low_13 (Length: 278)
Name: NF19213_low_13
Description: NF19213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19213_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 44751843 - 44752102
Alignment:
| Q |
1 |
attaaatgcatttagaagaaacaaatgattgtcatgttaaggtaaatagttatatttgatcaactaatattgtttcaagtatgcatatgatgaacacaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44751843 |
attaaatgcatttagaagaaacaaatgattgtcatgttaaggtaaatagttatatttgatcaactaatattgtttcaagtatgcatatgatgaacacaac |
44751942 |
T |
 |
| Q |
101 |
gtttgatattgtcaaaaatttattagtgaaatattgtatacatgttcagcaaaaataaaattgtgtac--ttttagtttgacaggtttatacctatcatg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44751943 |
gtttgatattgtcaaaaatttattagtgaaatattgtatacatgttcagcaaaaataaaattgtgtacttttttagtttgacaggtttatacctatcatg |
44752042 |
T |
 |
| Q |
199 |
ttacttgtgttcttttattactaaaatagttggattctaacatatttagtactttatgct |
258 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44752043 |
ttaattgtgttcttttattactaaaatagttggattctaacatatttagtactttatgct |
44752102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University