View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19213_low_18 (Length: 250)

Name: NF19213_low_18
Description: NF19213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19213_low_18
NF19213_low_18
[»] chr1 (1 HSPs)
chr1 (13-136)||(17812262-17812385)


Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 13 - 136
Target Start/End: Complemental strand, 17812385 - 17812262
Alignment:
13 aatattaaaatcatagataacataaattagaacaaaactggagcctccaacccacttgacattcctgtcatgtacatcttgaaataattcccaaactaag 112  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||    
17812385 aatattaaaaccatagataacataaattagaacaaaactggagcctccaacccacttgacattcctgtcatacacatcttgaaataattcccaaactaag 17812286  T
113 ttggtacgttttggaagaagcaga 136  Q
    ||||||||||||||||||||||||    
17812285 ttggtacgttttggaagaagcaga 17812262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University