View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19213_low_20 (Length: 241)

Name: NF19213_low_20
Description: NF19213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19213_low_20
NF19213_low_20
[»] chr1 (1 HSPs)
chr1 (1-225)||(17811998-17812221)


Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 17812221 - 17811998
Alignment:
1 cgagtccactaagttggcgacaccatatgatgacacgccctaaaacctactggattacggtacaggccgagatttcctcaccattaatccgagagctcct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17812221 cgagtccactaagttggcgacaccatatgatgacacgccctaaaacctactggattacggtacaggccgagatttcctcaccattaatccgagagctcct 17812122  T
101 taccaccccga-gggttactcatgtccgtaccccaggcatagatggctggagaagtgaggggttcaagaaagagagtgtcggagcgcgtgcagtgcaggt 199  Q
     |||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||  |||||||| |||| | ||||||||||||    
17812121 caccaccccgaggggttactcatgtccgtaccccaggaatagatggctggagaagtgaggggttcaagaa--agagtgtcagagcacatgcagtgcaggt 17812024  T
200 acaccatcccccttccagtggagaag 225  Q
    |||||| ||||||||| |||||||||    
17812023 acaccaccccccttccggtggagaag 17811998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University