View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19213_low_21 (Length: 238)
Name: NF19213_low_21
Description: NF19213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19213_low_21 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 24366502 - 24366265
Alignment:
| Q |
1 |
ttggtagtgaaattacaggaggtcatttattcttgtaactatttaatgtataatacattttgtatgattagattatttatctaatctagtcatgcccgtg |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24366502 |
ttggtagtgaaattacaggaagtcatttattcttgtaactatttaatgtataatacattttgtatgattagattatttatctaatctagtcttgcccgtg |
24366403 |
T |
 |
| Q |
101 |
tcttgtttatcactcattgggctcataccctcgtatctaagttctannnnnnnnnnnnnnnnnnnnnnnnngaattgtgaaagtcataattgttggttag |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||| | |
|
|
| T |
24366402 |
tcttgtttatcactcattgggttcataccctcgtatctaagttctatttttatttttattttttactttttgaatggtgaaagtcataattgttggttgg |
24366303 |
T |
 |
| Q |
201 |
gttagtatgttagcatggagcgggttcgaccttacatt |
238 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24366302 |
gttagtatgttagcatggatcgggttcgaccttacatt |
24366265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University