View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19213_low_23 (Length: 234)
Name: NF19213_low_23
Description: NF19213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19213_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 40668415 - 40668624
Alignment:
| Q |
18 |
ctattgtatctgaccaccttacaactactactggaggggcagatgaagatgatctatatagttaggtttt-tatgatgtgtttctagacttccctttcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40668415 |
ctattgtatctgaccaccttacaactactactggaggggcagatgaagatgatctatatagttaggttttttatgatgtgtttctagacttccctttcaa |
40668514 |
T |
 |
| Q |
117 |
atgggaaaacttcaagtctgctatttatttcacactattaagtttaattaccataaattggctactaccttttatttatgtttatattatgaattattga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40668515 |
atgggaaaacttcaagtctgctatttatttcacactattaagtttaattaccataaattggctactaccttttatttatgtttatattatgaattattga |
40668614 |
T |
 |
| Q |
217 |
tgatattctt |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
40668615 |
tgatattctt |
40668624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University