View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19213_low_7 (Length: 382)
Name: NF19213_low_7
Description: NF19213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19213_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 38824195 - 38824365
Alignment:
| Q |
1 |
agtaaaatatactagcttctatccattgtgacagtaaaacaacatagctgcaaaaatagtgcaatggatagacaaattcatcatattcgttctatcaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38824195 |
agtaaaatatactagcttctatccattgtgacagtaaagcaacatagctgcaaaaatagtgcaatggatagacaaattcatcatattcgtcctatcaaaa |
38824294 |
T |
 |
| Q |
101 |
tccatactaaaatagaaaggttttgatgagagtaattttcaccaatacagcacaaaacattgcaggcaggc |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38824295 |
tccatactaaaatagaaaggttttgatgagagtaattttcaccaatacagcacaaaacattgcagacaggc |
38824365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 288 - 369
Target Start/End: Original strand, 38824507 - 38824588
Alignment:
| Q |
288 |
aaaaataatttccaattaacacatatctttatttacaaagcatttaaaaaagtagtaaacatgaaatcgaagggaacattgt |
369 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38824507 |
aaaaattatttccaattaacacatatctttatttacaaagcatttaaaaaagtagtaaacatgaaatcgaagggaacattgt |
38824588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University