View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19214_high_14 (Length: 255)
Name: NF19214_high_14
Description: NF19214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19214_high_14 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 103 - 255
Target Start/End: Complemental strand, 31520484 - 31520332
Alignment:
| Q |
103 |
tataatatattcccaccaaacacaccatgcttttagctcttgattcgattgttgtctcttttccgttgaaattttcacaacaagcaaactaatctacccc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31520484 |
tataatatattcccaccaaacacaccatgcttttagctcttgattcgattgttgtctcttttccgttgaaattttcacaacaaacaaactaatctacccc |
31520385 |
T |
 |
| Q |
203 |
ttagcatcatctactaattaattcgatccatgtgtgttacaaattatagtatt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31520384 |
ttagcatcatctactaattaattcgatccatgtgtgttacaaattatagtatt |
31520332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 31521069 - 31520985
Alignment:
| Q |
20 |
aaaattagagaaatggattttctacgagtaataatgttaaatccggtatcatttgatttttgtacttatttttaaaatacaagta |
104 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||| ||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
31521069 |
aaaattagagaaatggattttctacaagtaatgatgtcaaatccggtgtcatttgatttttgtgcttatttttaaaatacgagta |
31520985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University