View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19214_high_17 (Length: 238)
Name: NF19214_high_17
Description: NF19214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19214_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 44838272 - 44838052
Alignment:
| Q |
1 |
aagagtagctggagcaaggtatactcaatattcttcttctcattggagtgataattttttcatccaaacacacccttatggatttgaccttaatggttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44838272 |
aagagtagctggagcaaggtatactcaatattcttcttctcattggagtgataatttttgcatccaaacacacccttatggatttgaccttaatggttta |
44838173 |
T |
|
| Q |
101 |
tctgaggaagaaaatagagacattgaactagcacagtttctctatgtagcagctgaaagagtaagtttgcaacaatatgaacgtgcnnnnnnnttacttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44838172 |
tctgaggaagaaaatagagacattgaactagcacagtttctctatgtagcagctgaaagagtaagtttgcaacaatatgaacgtgcaaaaaaattacttt |
44838073 |
T |
|
| Q |
201 |
tatattgtcaatggaattctt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44838072 |
tatattgtcaatggaattctt |
44838052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University