View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19214_high_19 (Length: 234)
Name: NF19214_high_19
Description: NF19214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19214_high_19 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 234
Target Start/End: Complemental strand, 35279202 - 35278985
Alignment:
| Q |
17 |
atatatgtctacttttgcactttctgagaatcttgatattgcaacaaaatgcagacaaatgtagttgaagcgcaaatgcagcttataatatagattctta |
116 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35279202 |
atatatgtctacttttgcactttctgcgaatcttgatattgcaacaaaatgcagacaaatgtagttgaagcgcaaatccagcttataatatagattctta |
35279103 |
T |
|
| Q |
117 |
agcttgtatgattatgttttgcaaagggtgatggtgataacaacggatacatattcagatcttctgcatattcttttctttcttctaatatcattcatta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35279102 |
agcttgtatgattatgttttgcaaagggtgatggtgataacaacggatacatattcagatcttctgcatattcttttctttcttctaatatcattcattt |
35279003 |
T |
|
| Q |
217 |
ctttgactgattatttaa |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35279002 |
ctttgactgattatttaa |
35278985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University